Review



plko 1 trc control  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc plko 1 trc control
    Plko 1 Trc Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 361 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 trc control/product/Addgene inc
    Average 96 stars, based on 361 article reviews
    plko 1 trc control - by Bioz Stars, 2026-03
    96/100 stars

    Images



    Similar Products

    plko 1 trc control  (Addgene inc)
    96
    Addgene inc plko 1 trc control
    Plko 1 Trc Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 trc control/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 trc control - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    shrna plko.1 trc control  (Addgene inc)
    90
    Addgene inc shrna plko.1 trc control
    Shrna Plko.1 Trc Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna plko.1 trc control/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    shrna plko.1 trc control - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    plko.1 control shrna  (Addgene inc)
    90
    Addgene inc plko.1 control shrna
    Plko.1 Control Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko.1 control shrna/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plko.1 control shrna - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    plko.1-shgfp control  (Addgene inc)
    90
    Addgene inc plko.1-shgfp control
    Plko.1 Shgfp Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko.1-shgfp control/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plko.1-shgfp control - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    j urn al pr e p roo f 22 control  (Addgene inc)
    96
    Addgene inc j urn al pr e p roo f 22 control
    J Urn Al Pr E P Roo F 22 Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/j urn al pr e p roo f 22 control/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    j urn al pr e p roo f 22 control - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    control scrambled sequence  (Addgene inc)
    93
    Addgene inc control scrambled sequence
    Control Scrambled Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control scrambled sequence/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    control scrambled sequence - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    control scrambled sequence gcgcgctttgtaggattcgtt  (Addgene inc)
    93
    Addgene inc control scrambled sequence gcgcgctttgtaggattcgtt
    Control Scrambled Sequence Gcgcgctttgtaggattcgtt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control scrambled sequence gcgcgctttgtaggattcgtt/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    control scrambled sequence gcgcgctttgtaggattcgtt - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    plko 1 trc plasmid  (Addgene inc)
    96
    Addgene inc plko 1 trc plasmid
    Plko 1 Trc Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 trc plasmid/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 trc plasmid - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    control vector plko 1 puro  (Addgene inc)
    96
    Addgene inc control vector plko 1 puro
    Control Vector Plko 1 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control vector plko 1 puro/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    control vector plko 1 puro - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    lentiviruses expressing control shrna  (Addgene inc)
    93
    Addgene inc lentiviruses expressing control shrna
    Lentiviruses Expressing Control Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviruses expressing control shrna/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    lentiviruses expressing control shrna - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier

    Image Search Results